Andrew T. Burden
OPS Diagnostics, LLC
The Synergy™ Plant DNA Extraction Kit was modified to a two-step purification method that involved 1) capturing impurities on a grinding matrix, and 2) binding DNA onto a silica spin column followed by elution. This contrasts to the original Synergy™ method, which involved capturing impurities followed by alcohol precipitation. A comparison between the original Synergy™ method, the two-step Synergy™, and the Qiagen DNeasy kit produced comparable results, with the two-step Synergy™ yielding the most DNA. Subsequent modification of the Synergy™ plant homogenization buffer, by raising the pH, further improved the yields and qualities of DNA. During this analysis, silica spin columns were found to remove EDTA from the elution buffers, which could drastically effect 260/230 ratios. Elution of DNA from columns using water allows for more accurate spectrophotometric readings. The two-step Synergy™ method was successfully tested on sorghum, rice, rapeseed, and Anthurium.
In the early days of molecular biology, routine isolation of DNA was anything but that, requiring difficult purification protocols often involving organic extractions and high speed centrifugation with cesium salts. With the introduction of drip columns, and specifically spin columns, isolation of all nucleic acids, from plasmids to RNA, became much less laborious and more time efficient. The commercialization of related nucleic acid isolation kits has lead to high reproducibility, which has greatly aided researchers.
Even though the use of commercial DNA isolation kits are now commonplace, not all sample types are effectively purified using these kits. For instance, there are still difficulties associated with isolating DNA from many plants due to the biochemical heterogeneity that exists between species. As a group, the carbohydrate, lipid and protein compositions are extremely diverse. From a molecular biology standpoint, polysaccharides and polyphenols are specifically problematic contaminants. To exclude these from nucleic acid preparations, the detergent CTAB (hexadecyltrimethylammonium bromide) and additive PVP (polyvinylpyrrolidone) are used to separate out or bind up polysaccharides and polyphenols, respectively. However, these additives can carry over into the final preparation and interfere with the spectrophotometric assessment of purity.
Though not perfect, it is important to note that plant DNA isolation kits are particularly valuable in that they avoid the need for organic extractions (e.g., chloroform/isoamyl alcohol) associated with most homegrown protocols. As chloroform is considered a hazardous substance, its use as a routine component of plant DNA isolation procedures has become cumbersome in many institutions that follow strict safety guidelines. Commercial kits help to avoid this problem.
Many commercial kits use spin column technology to capture DNA and rinse away contaminants. The process relies on binding DNA to a silica matrix, followed by washing and eluting. This is a standard chromatographic approach where centrifugation is used as an alternative to a pump for delivering solvent to a column. However, even with multiple washing steps, removing residual contaminants and buffer solutes can at times be ineffective. The Synergy™ chemistry developed by OPS Diagnostics takes a different path to isolate plant DNA. Synergy™ captures contaminants during the bead beating process and leaves DNA in the supernatant, which is subsequently precipitated using alcohol. Synergy™ employs a reverse chromatographic process of capturing the impurities while letting the DNA stay in solution.
In previous experiments, Synergy™ Plant DNA Extraction Kit chemistry has been tested against and compared to other DNA extraction methods and products (link). Under controlled conditions, Synergy has shown equal or better DNA yields and purity when compared to Qiagen DNeasy and traditional CTAB protocols. However in practice, the results of any DNA purification process may yield less than ideal results because of plant variation and sample overloading. An ideal protocol would be sufficiently robust to handle variations in sample load and type. Consequently, a modified Synergy™ protocol was explored that incorporated a spin column into the final step of the purification process. By substituting a spin column for alcohol precipitation, a second level of purification can be added to the Synergy™ process without significantly changing the number of manipulation steps and processing time. This study will examine the modification of the Synergy™ protocol to include an additional spin column purification step, including a comparison to the Qiagen Plant DNeasy protocol.
DNA Isolation Methods - Three protocols were used to isolate plant DNA. Process development used sorghum, while process validation also used Anthurium, rapeseed, and rice.
Synergy Protocol - For protocol optimization, three leaf punches (approximately 15 mg) of sorghum were used. All samples were homogenized using the HT Mini™ homogenizer at 4,000 RPM for 2 minutes in Synergy disruption tubes with 500 µl homogenization buffer. Processed sample tubes were centrifuged for 5 minutes at 15,000 x g, and the supernatant was then transferred to a clean tube. RNase A solution (5 µl) was then added to each sample, which was vortexed and allowed to incubate for 15 minutes at room temperature. Isopropanol (0.7 volumes) was added and mixed with the lysates, followed by a 15 min. incubation at -20°C. The DNA was then pelleted by centrifugation for 5 minutes at 15,000 x g. The supernatant was decanted and the pellet was washed twice with ice cold 70% ethanol. The pellet was dried briefly in a SpeedVac and then dissolved in TE buffer (10 mM Tris, pH 8, 1 mM EDTA).
Synergy Spin Column Protocol - For protocol optimization, three leaf punches (approximately 15 mg) of sorghum were used. Samples were homogenized using the HT Mini™ homogenizer at 4,000 RPM for 2 minutes in Synergy disruptions tubes with 500 µl homogenization buffer. Following homogenization, the tubes were centrifuged for 5 minutes at 15,000 x g, and the supernatant was transferred to a new tube. RNase A solution (5 µl) was then added to each sample, which was vortexed and allowed to incubate for 15 minutes at room temperature. Lysates were then mixed with 0.7 volumes isopropanol and incubated at -20°C for 15 minutes. The lysate/alcohol solution was transferred to a 1 ml silica spin column (OPS Diagnostics) placed within a collection tube and then centrifuged for 2 minutes at 7500 x g. The collection tube was emptied and 500 µl ice cold 70% ethanol was added, which was then centrifuged for 2 min. at 7500 x g. The washing process was repeated, but the final centrifugation was for 5 minutes at 15,000 x g to dry the column. The spin column was placed in a clean 1.7 ml centrifuge tube. DNA was eluted by adding molecular biology grade water, incubating for 5 minutes at room temperature, and then centrifuged for 1 min. at 7500 x g.
Qiagen DNeasy Plant Mini Kit Protocol - Samples (15 mg) were disrupted without buffer using the HT Mini™ and 1.4 mm zirconium disruption tubes (PFAW 1400-100-19). Homogenized samples were mixed with 400 µl Buffer AP1 and supplemented with 4 µl RNase A. This mixture was vortexed and incubated at 65°C for 10 minutes. Following incubation, 130 µl Buffer AP3 was added, mixed and then placed on ice for 5 minutes. The lysate was centrifuged at 15,000 x g for 5 min. to pellet the debris. The supernatant was transferred to a QIAshredder with a collection tube and centrifuged at 15,000 x g for 2 min. The filtrate was transferred to a new tube and 1.5 volumes of Buffer AW1 were added. The solution was mixed by pipetting and then 650 µl was transferred to a DNeasy Mini spin column. The column was placed in a receiving tube and centrifuged for 1 min. at 6000 x g. The remaining lysate was passed through the column as described above. The column was transferred to a new tube and washed by adding 500 µl Buffer AW2 followed by centrifugation for 1 min. at 6000 x g. This was repeated, but with centrifuging for 2 min. at 15,000 x g. The column was placed in a new collection tube and the DNA was eluted by adding 100 µl Buffer AE followed by centrifugation for 1 min. at 6000 x g. This elution step was repeated.
Yield and Purity Analysis - DNA concentration was measured using both fluorescence and UV absorbance. The GloMax Jr. fluorometer was used to assess DNA concentration using the QuantiFluor dsDNA System (Promega, Madison, WI). DNA was measured against a Lambda DNA standard curve. The QuantiFluor ssDNA System was used to assess single stranded DNA. DNA was measured spectrophotometrically using a DeNovix DS11+ spectrophotometer (DeNovix, Wilmington, DE). This instrument directly measures 1 µl of sample, returning a 220-340 nm scan and calculated ratios at 260/230 and 260/280.
qPCR Assessment - Sorghum DNA preparations were analyzed by qPCR to confirm relative yields and that isolated DNA could be amplified. A qPCR primer set targeting a sequence in the Sorghum bicolor gamma kafirin gene promoter (Genbank number AY294252.1) was used. The forward (CGTACGCCTATGCACATCTC) and reverse (GTCGAGTTCTTGTCTGCTCTT) primers generate a 91 bp product with an internal probe (56-FAM/CCACCACTG/ZEN/GTCTTCATTCAGCCT/3IABkFQ) containing the fluorophor 6-FAM™, quencher Iowa Black® FQ, and secondary internal quencher ZEN™ (Integrated DNA Technologies, Coralville, Iowa). Quantitative PCR was performed on a Bio-Rad IQ5 Multicolor Real Time PCR System. Cycling parameters involved an initial denaturation at 95°C for 3 min., followed by 40 cycles with melting at 95°C for 15 seconds and annealing/extension at 60°C for 45 sec.
Comparison of Basic Methods: An initial assessment of the two-step Synergy™ purification protocol with spin column was performed to gather baseline data. The original Synergy™, Qiagen DNeasy and Synergy™ spin column protocols were performed in parallel using 15 mg of fresh sorghum leaf. DNA isolated from each process was measured for yield, purity (260/230 and 260/280 ratios), and qPCR threshold. Table 1 summarizes yield and purities for these protocols.
| Method | Sample | Yield | 260/230 | 260/280 | qPCR Threshold |
| Qiagen DNeasy | 15 mg | 204.0 ng | 0.79 | 1.19 | 28.68 |
| Synergy™ | 15 mg | 255.4 ng | 2.58 | 2.31 | 28.34 |
| Synergy™ SC | 15 mg | 410.7 ng | -0.86 | 1.50 | 28.00 |
SC: Abbreviation for Spin Column
All methods extracted a significant amount of DNA for such a small mass of sample. DNA yields from 15 mg sorghum using a traditional CTAB protocol are approximately half the yield of Synergy™ (data not shown). The surprising observation is that the Synergy spin column method, without optimization, generated yields greater than both DNeasy and basic Synergy. The relative position of the qPCR thresholds supports the data, while also indicating that there are not significant quality issues between the samples.
Although yields are good and verified by qPCR, purities as measured by 260/230 and 260/280 ratios are not ideal. An ideal 260/230 ratio of pure DNA is approximately 2.0. Lower 260/230 ratios indicate the DNA has polysaccharide and/or salt impurities, which might be the issue with the Qiagen preparation. The high Synergy ratio, at 2.58 is difficult to explain. High ratios can occur if spectrophotometers are improperly blanked, but this possibility was omitted. Most notable is the negative 260/230 ratio for the Synergy™ spin column method. The result was repeatable and required additional analysis (discussed below). DNA purity as measured by 260/280 was also less than ideal, with Qiagen and Synergy™ spin column methods being less than 1.8, while Synergy was well above. Protein contamination may cause the lower ratios, but the higher ratio may be explained by the presence of RNA and single stranded DNA.
Though only examined briefly (details to follow in a later application note), single-stranded DNA may be a significant product of bead beading. The shearing forces of the beads generate smaller DNA fragments, and that coupled with heat generated from bead collisions, may lead to partial denaturation. Samples were tested for single-stranded DNA using the Promega QuantiFluor ssDNA System and were found to have significant levels. Single-stranded DNA has greater absorbance at 260 than double-stranded DNA, a characteristics that could shift the 260/280 ratio upward (as noted above). Furthermore, even after RNase A treatment, it is possible that significant levels of RNA may still be present in the preparations. This would be due to the decrease of RNase A activity associated with high concentrations of salt used in CTAB protocols.
Impact of Spin Column on Absorbance Measurements: The negative 260/230 ratio associated with Synergy™ spin column protocol was repeatable, and thus investigated in further detail. The negative reading (-0.86) was due to a lower absorbance than the TE used to blank the DeNovix spectrophotometer. As the DNA was eluted with TE buffer, some component which absorbed in the 230 nm range was either lost or no longer absorbing. Absorbance scans of several DNA preparations were shown to consistently have negative absorbance following elution with TE buffer (Fig. 1).
Figure 1. DNA eluted from spin columns when blanked against TE buffer.
To test the effect that spin columns have on TE buffer absorbance, a collection of commercially available columns were analyzed. TE buffer was added to columns, passed through by centrifugation, and then analyzed using the DeNovix spectrophotometer. In all cases, the absorbance scan of buffers passed over the column was lower in the 230 nm range than TE buffer used to blank the instrument (Fig. 2). Of the components in TE buffer, the EDTA absorbs strongly in the 230 nm range, thus it is concluded that silica spin columns are removing EDTA from the buffer. The reason for this binding is unknown. As a result of this observation, water was used to elute DNA from the spin columns and blank the spectrophotometer. It should be noted that for studies where 230 nm measurements are not vital, it is recommended that elution is done with TE buffer in order to protect the DNA from nucleases.
Figure 2. Absorbance scans of TE buffer eluents from commercial spin columns.
Effect of pH on Yield from Spin Column:
The original Synergy homogenization buffer is acidic (pH 5), which is effective for its designated process. However the addition of a silica based spin column in the purification processes required reassessing the pH of the lysate as the surface of silica may or may not bind DNA efficiently at pH 5. Consequently, Synergy homogenization buffer was prepared at pH 5 and pH 8, and then tested using the Synergy spin column protocol. Initial binding tests used sorghum, and the results are summarized in Table 2.
| Measurement | Synergy, pH 5 | Synergy, pH8 |
| Absorbance (ng/µl) | 88.02 | 43.64 |
| Fluorescence (ng/µl) | 5.15 | 29.50 |
| 260/230 Ratio* (ideal 2.0) | 2.74 | 2.67 |
| 260/280 Ratio* (ideal 1.8) | 1.99 | 1.88 |
Lambda DNA gave a 260/230 ratio of 2.59 and 260/280 ratio of 1.87.
This data shows significant differences in the yield as measured by absorbance and fluorescence. Though it should not be surprising that data from two quantitation methods are different, the degree by which they differ is noticeable. One explanation is that significant RNA is present in the spin column protocol when using pH 5 buffer.
The fluorescence data shows that pH 8 yields greater amounts of DNA. The absorbance data is contrary to the fluorescence reading, a result which may be related to the RNA contamination. RNase A exhibits activity at pH 6-10, thus Synergy buffer, pH 5, most probably retains significant amounts of RNA from the homogenate. This RNA is not measured when assessing DNA concentration using fluorescence, but will contribute to the absorbance readings, while also increasing the 260/280 ratio. Synergy homogenization buffer at pH 8 provides Ribonuclease A with near ideal conditions for activity, which will reduce the amount of contaminating RNA.
Synergy spin column protocol with homogenization buffers at pH 5 and 8 were subsequently used to isolate DNA from Anthurium, rice and rapeseed. The DNA was analyzed using a DeNovix spectrophotometer. The results are illustrated in Fig. 3. It can clearly be seen that pH 8 Synergy homogenization buffer yielded more DNA than pH 5 buffer.
Figure 3. Absorbance of DNA isolated from plant samples using Synergy™ homogenization buffer at pH 5 and 8.
Synergy™ DNA isolation chemistry, whether used with a silica spin column or not, can rapidly yield DNA that can be analyzed by qPCR. Results are equal or comparable to Qiagen's DNeasy protocol. When optimized by changing the pH of the plant homogenization buffer, the Synergy™ protocol supplemented with a silica spin column yields greater amounts and more purified DNA than other methods. The improved process has successfully been tested on sorghum, Anthurium, rice, and rapeseed.